hrvatski
Search:
art & technology · art & science · science & technology · information art · art
Polypticha

Some 10 centuries ago the Greek lexicographer Souidas mentioned in a list of earlier works the existence of a book called Ammoskopia, now lost, by an Orphic writer known as Brotinos. In Greek, the title is self-explanatory. Ammoskopia was a book about divination of sand. Diviners and magicians have always been attached to the idea that endless minute differences may be perceived among objects that appear exactly alike to the unaccustomed eye; that even the smallest grain of sand can hold all the wisdom of the world.

The digital age seems to have confirmed this notion. Through the manipulation of crystals of silicon (sand) we have created transistors and computer chips and invested them with our voice (crystal radio sets are also made with crystals of silica) and “memory”. In one sense, another Stone Age, or at least, a “sand age” has replaced the industrial one. Condensation of large amounts of information into ever and ever smaller physical volumes has marked the course of technology. The house-sized ENIAC (ca. 1946) has become today’s laptops and palm pilots. It has been an epoch of miniaturization.

Even the most inexperienced diviner would have no problem con-cluding that substantial increases in available information density are forthcoming. Indeed, computers continue to become smaller and more powerful. Meanwhile, another information-handling ma-terial has appeared that may soon completely overwhelm the data storage capacity of semiconductor chips.

Rapid advances in genetics and molecular biology have not left computer science untouched. Programmers have constructed mas-sively parallel “neural networks” and so-called “genetic algorithms” drawn from observations of biological models. Significant research is currently underway that promises to yield biologically based in-novations in computer hardware design as well.

Over the past few years, scientists have realized that a single gram of DNA can contain at least as much information as a trillion CDs. A gram of DNA contains 1021 DNA bases or, translated into the vernacular of computer science, a gram of DNA contains at least 108 tera-bytes of data. Hence, a few grams of DNA have the potential to store all of the data stored in the world.
 
In nature however, DNA already has a job to do and very specific data sets to contain. The information handling operations of DNA have been carried out with elegant precision since long before the appearance of Homo sapiens. Over the past few tens of thousands of years, human beings have systematically modified a large part of the biological environment. Even if all of the genetic modifications historically undertaken for strictly scientific purposes are included, art, or at least aesthetics has filled a predominant role in the legacy of human interference with the natural evolution of many different species. Aesthetics, not science, has inspired the creation of say, the softest wool, or the prettiest flower.

 

Artists have of late renewed efforts to create grotesque and arbitrary changes in phenotype of a variety of organisms. Like it or not, science and biotechnology have given them much more power-ful tools to do so than they have ever had before. Now, as if there were no time-worn practices or produce to reflect our historic inter-ventions, there are suddenly new concerns that we have gone too far; that the implementation of our knowledge of genetics can only lead to disaster and that it should, like the fabled apple, become forbidden fruit. Yet the very same scientific advances have also yield-ed deep new understandings of the intricate complexity of the natural biological environment and enhanced our awareness of in-creasingly critical issues of conservation and ecology and the need for preservation of natural diversity. Science itself calls for environ-mentally responsible genetics.

With crops and livestock designed to be more abundant and nutri-tious and resistant to parasites, disease and the ravages of climate, there is an obvious metaphor about the myth of Paradise. It seems that biotechnology is now and always has been engaged in rebuild-ing that garden. It should be pointed out here that the principal element in the story of Paradise was not freedom from want and toil. Rather, it was an element that corresponds to what we speak of together here as biology and literacy: that there was a tree — and a fruit — of knowledge.
 
Human beings will ultimately merge information management and biological systems not only because very large amounts of informa-tion can be stored in such an archive. Living organisms can be en-gineered to rigorously conserve that database and cellular machi-nery can be co-opted to repair an archive that is damaged by mecha-nical injury or radiation. A living database will faithfully reproduce itself much faster and in vastly larger quantities than any human publisher or printmaker could reproduce any newspaper or laser disc. Large-scale biological archives are inevitable and they will impact the arts as dramatically as they will every other branch of knowledge.
 
But not just any arbitrary DNA sequence can be successfully inserted into an organism. If that sequence represents no benefit to the host, it will likely be deleted or grossly rearranged. Because cells normally translate their complements of DNA into protein, random integra-tion of human “memory” would result in unwanted or unintended translation products. Some might turn out to pathogenic or fatal to the host or other organisms.
 
It can be simply stated here that most of the artworks and instal-lations comprising Polyptycha hold what we call “DNA manifolds”, a many-folded symmetry derived from natural operations of DNA and the genetic code. It is a thing that coincides within itself and so it seems automatically possessed of its own harmony and grace; so much so, that we think of it ourselves — and have created it exclusively — as art. Still, it is like an artist’s brush, a tool that we know can be disposed to other things. Like the classical “golden section” or “divine proportion”, DNA manifolds can be broadly applied to art, music, architecture and other fields outside the more obvious applications with biology and information science. We have used these manifolds to hold one of the surviving fragments of Heraclitus in plants, sand, playing cards, glass bottles, paintings and formal sculpted objects — as well as in DNA itself. Without any need for the special license that artists often require, we can say once and for all that we have found a way to nest the world within itself; a way to read the grains of sand.

Part of its special elegance lies in the fact that DNA manifolds can be used to nest many layers of human “memory” within DNA se-quences of natural genes without altering the size of initially unen-coded genes. The cell requires no more energy or machinery than it would need to operate with its own natural genes. More importantly, the manifolds are nested there in such a way that biological trans-lation of the natural genes remain unaltered. A gene for say, insulin that holds a set of manifolds still makes insulin and nothing else. We have written something Heraclitus said into a gene for the eyes of a fly:

 

TCGAAAGGTAAGTACCTGTACTCTATAGGCCATATT

Critics may all too justifiably cry “Science!” It is about science and with science, after all, and there is something more:

CTGTTCCTTTTGGCACAGATTTAACTGCACTAGCTT
TTCGAGGGGGCGATTAACAGTAAACATGACGGCAA
TAACGGCAAGAAAAAAAACAAGCAGTTGTTTAGAAT
ATATGTTGGATACAGCCTCAGGAGAGCAAGATCTCT
GAGAGCGAGGTATGCGTCCACGAGGAAGTTGACCA
TGAGAATGGCCAGCCGTAATTAGTCTTCTGGGAGGT
CCGCGGCGGAGAAATTGTCTGTTAGCAGAATGACAT
TGCCGGAGTTGGGTCACGTTGTATTCGATGACGTGC
AACTCATTTCTCCTGGCTCCACGTCCGCTCACTGGCT
TATTTCTAGACCCAGCCTGGCGTAACGTAATCATGA
AAGGTATGATAATCACCTCCGCTATACCGGCACCGA
ACCTGAATTTAAGAAGAAGCCGCCGAAAAGCCGTAA
TGGCATGATCACAGGAGGACCGACTGATAGTGCAAT
AGAGGTAGAAGAACTCGCACAAGATATAAGGTATCC
CAAAGACGTAGACACCTTGGCAACTAGAGTTACCTCT
GCGCGCCAGCTGAAGAAATGTAGTACTCCTGCAAGGT
CTCCGATCATAGGGTAGGCAATTGCAGTCAAAGCGAG
CGGGACGGTCCGTAAGTCTGGGAACAGCACGATAGTC
CTTCCACGTAAGTACGTCAGCCAAAGGTAATCTCGCC
TCAGGGCCTCCTTGATAAAAACCGGCTCTTCTGAAGT
TAATACCTAAATTGAAAGCATACACTAGAAAGTGTCT
AAACTTCTGATATGCAAATGCATACTCAACAAACCGT
ACATATACCGTGGGAAGGACGTCTTGAAAGGACACGT
TGGACAAGAGGAAGAAGATGGGTCTGTGGACATTCAT
CACGCCCACTTGCGCGAACTTCTGGCACAAAAAGACGA
AGCGAAT

“The Lord whose oracles are at Delphi wishes neither to conceal nor reveal, but rather to signify.”

 
Joe Davis


















ABC